Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3482736
End position: 3482771
Length: 36

DNA sequence
>NC_013406, from 3482736 to 3482771 (36 bp); Geobacillus sp. Y412MC10 TCTGCGATTCCTCCGGCGATTCCTTCTGCGGCTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3479915-3482920	Sequence	GYMC10_3024 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 3482920 to 3479915)