Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 251607
End position: 251642
Length: 36

DNA sequence
>NC_013406, from 251607 to 251642 (36 bp); Geobacillus sp. Y412MC10 TTGTTGCTGCTGTTGTTGCCGCTGTTATTGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250293-252995	Sequence	GYMC10_0219 - S-layer domain-containing protein (Protein is coded in complementary strand; from 252995 to 250293)