Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 1833968
End position: 1834003
Length: 36

DNA sequence
>NC_013406, from 1833968 to 1834003 (36 bp); Geobacillus sp. Y412MC10 AAACCAGAATTCAAACCAGAATACAAACCGGAGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1833264-1835006	Sequence	GYMC10_1555 - peptidoglycan-binding lysin domain-containing protein