Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 6046687
End position: 6046716
Length: 30

DNA sequence
>NC_013406, from 6046687 to 6046716 (30 bp); Geobacillus sp. Y412MC10 GTGAGGTAAGGTGAGGTGAGGTGAGGTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6041727-6046691	Sequence	GYMC10_5368 - coagulation factor 5/8 type domain-containing protein