Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4638771
End position: 4638800
Length: 30

DNA sequence
>NC_013406, from 4638771 to 4638800 (30 bp); Geobacillus sp. Y412MC10 GGCAGCCGCAGCGGCAGTGGCGGCGGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4637671-4639758	Sequence	GYMC10_4059 - hypothetical protein (Protein is coded in complementary strand; from 4639758 to 4637671)