Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3950677
End position: 3950706
Length: 30

DNA sequence
>NC_013406, from 3950677 to 3950706 (30 bp); Geobacillus sp. Y412MC10 AACCACCATAAACGACCAGAAACCGCCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3948611-3951685	Sequence	GYMC10_3416 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 3951685 to 3948611)