Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3862573
End position: 3862602
Length: 30

DNA sequence
>NC_013406, from 3862573 to 3862602 (30 bp); Geobacillus sp. Y412MC10 CTCCTGCCCCTGCTCCTGCTTCTGCTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3860954-3862735	Sequence	GYMC10_3340 - peptidase S41 (Protein is coded in complementary strand; from 3862735 to 3860954)