Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 7015347
End position: 7015373
Length: 27

DNA sequence
>NC_013406, from 7015347 to 7015373 (27 bp); Geobacillus sp. Y412MC10 CCTTCCCGGTCTTCCCGGTCTTCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7014933-7015481	Sequence	GYMC10_6251 - uracil-DNA glycosylase superfamily protein (Protein is coded in complementary strand; from 7015481 to 7014933)