Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 6533642
End position: 6533668
Length: 27

DNA sequence
>NC_013406, from 6533642 to 6533668 (27 bp); Geobacillus sp. Y412MC10 TCCTCCTGATCCTCCTGATCCTCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6533597-6535192	Sequence	GYMC10_5828 - S-layer domain-containing protein (Protein is coded in complementary strand; from 6535192 to 6533597)