Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 5967451
End position: 5967477
Length: 27

DNA sequence
>NC_013406, from 5967451 to 5967477 (27 bp); Geobacillus sp. Y412MC10 CATGCCGCCCATTCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5967446-5969074	Sequence	GYMC10_5295 - chaperonin GroEL (Protein is coded in complementary strand; from 5969074 to 5967446)