Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4815601
End position: 4815627
Length: 27

DNA sequence
>NC_013406, from 4815601 to 4815627 (27 bp); Geobacillus sp. Y412MC10 GCTCCTGTTACTCCTGTTACTCCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4813537-4816806	Sequence	GYMC10_4226 - hypothetical protein (Protein is coded in complementary strand; from 4816806 to 4813537)