Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3921730
End position: 3921756
Length: 27

DNA sequence
>NC_013406, from 3921730 to 3921756 (27 bp); Geobacillus sp. Y412MC10 GTTGTTTCCGTTGTTTCCATTGTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3920474-3926386	Sequence	GYMC10_3397 - metallophosphoesterase (Protein is coded in complementary strand; from 3926386 to 3920474)