Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 6569405
End position: 6569428
Length: 24

DNA sequence
>NC_013406, from 6569405 to 6569428 (24 bp); Geobacillus sp. Y412MC10 ATGCCGATACCGACGCCGATACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6568919-6569824	Sequence	GYMC10_5856 - hypothetical protein (Protein is coded in complementary strand; from 6569824 to 6568919)