Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 6314585
End position: 6314608
Length: 24

DNA sequence
>NC_013406, from 6314585 to 6314608 (24 bp); Geobacillus sp. Y412MC10 CCGATCCTGATCCTGATCCTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6314568-6316049	Sequence	GYMC10_5632 - FAD linked oxidase domain-containing protein (Protein is coded in complementary strand; from 6316049 to 6314568)