Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 5894227
End position: 5894250
Length: 24

DNA sequence
>NC_013406, from 5894227 to 5894250 (24 bp); Geobacillus sp. Y412MC10 GCCTTGACCTTGGCCTTGACCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5893847-5895544	Sequence	GYMC10_5219 - hypothetical protein (Protein is coded in complementary strand; from 5895544 to 5893847)