Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 5789585
End position: 5789608
Length: 24

DNA sequence
>NC_013406, from 5789585 to 5789608 (24 bp); Geobacillus sp. Y412MC10 TCCTCTTCATCTTCATCTTCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5789174-5789737	Sequence	GYMC10_5122 - hypothetical protein (Protein is coded in complementary strand; from 5789737 to 5789174)