Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 5763648
End position: 5763671
Length: 24

DNA sequence
>NC_013406, from 5763648 to 5763671 (24 bp); Geobacillus sp. Y412MC10 TGGTGATGATGATGATGATGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5763252-5764361	Sequence	GYMC10_5096 - cell wall-active antibiotics response protein (Protein is coded in complementary strand; from 5764361 to 5763252)