Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4633032
End position: 4633055
Length: 24

DNA sequence
>NC_013406, from 4633032 to 4633055 (24 bp); Geobacillus sp. Y412MC10 TTACAACATTTCAACATTACAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4633049-4633846	Sequence	GYMC10_4053 fabG 3-ketoacyl-(acyl-carrier-protein) reductase (Protein is coded in complementary strand; from 4633846 to 4633049)