Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4584219
End position: 4584242
Length: 24

DNA sequence
>NC_013406, from 4584219 to 4584242 (24 bp); Geobacillus sp. Y412MC10 TCCCCATCCCGATCTCCATGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4583915-4585021	Sequence	GYMC10_4009 - hypothetical protein (Protein is coded in complementary strand; from 4585021 to 4583915)