Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3494742
End position: 3494765
Length: 24

DNA sequence
>NC_013406, from 3494742 to 3494765 (24 bp); Geobacillus sp. Y412MC10 TTGCCGTTGCTGCTGCCGTTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3494702-3494965	Sequence	GYMC10_3033 - hypothetical protein (Protein is coded in complementary strand; from 3494965 to 3494702)