Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 2289127
End position: 2289150
Length: 24

DNA sequence
>NC_013406, from 2289127 to 2289150 (24 bp); Geobacillus sp. Y412MC10 GGCAAGGGTAAGGGCAAAGGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2287025-2289163	Sequence	GYMC10_1955 - serine/threonine protein kinase with PASTA sensor(s)