Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 1949428
End position: 1949451
Length: 24

DNA sequence
>NC_013406, from 1949428 to 1949451 (24 bp); Geobacillus sp. Y412MC10 AGGCCGATGCCGATGCCGAGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1948972-1949841	Sequence	GYMC10_1649 - hypothetical protein (Protein is coded in complementary strand; from 1949841 to 1948972)