Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 1580928
End position: 1580951
Length: 24

DNA sequence
>NC_013406, from 1580928 to 1580951 (24 bp); Geobacillus sp. Y412MC10 GTTGCTGCTGCTGTTGTTCTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1579264-1582746	Sequence	GYMC10_1333 - copper amine oxidase domain-containing protein (Protein is coded in complementary strand; from 1582746 to 1579264)