Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 895766
End position: 895789
Length: 24

DNA sequence
>NC_013361, from 895766 to 895789 (24 bp); Escherichia coli O26:H11 str. 11368 TTCCTTTCTTGCTTTCTTCCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 895438-896043	Sequence	ECO26_0838 - essential recombination function protein (Protein is coded in complementary strand; from 896043 to 895438)