Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 4797088
End position: 4797135
Length: 48

DNA sequence
>NC_013361, from 4797088 to 4797135 (48 bp); Escherichia coli O26:H11 str. 11368 AACCTGCACCTGCACCTGCACCTGCACCTGCACCTGCACCTGCACCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4795963-4797186	Sequence	ECO26_4786 hemX uroporphyrinogen III C-methyltransferase