Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 4626569
End position: 4626592
Length: 24

DNA sequence
>NC_013361, from 4626569 to 4626592 (24 bp); Escherichia coli O26:H11 str. 11368 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4626129-4627031	Sequence	ECO26_4636 dppC dipeptide transporter (Protein is coded in complementary strand; from 4627031 to 4626129)