Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 3586409
End position: 3586435
Length: 27

DNA sequence
>NC_013361, from 3586409 to 3586435 (27 bp); Escherichia coli O26:H11 str. 11368 GTCGAAGAAGTTGAAGAAGTTGAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3586092-3586442	Sequence	ECO26_3639 yfiA translation inhibitor protein RaiA