Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 3273485
End position: 3273509
Length: 25

DNA sequence
>NC_013361, from 3273485 to 3273509 (25 bp); Escherichia coli O26:H11 str. 11368 GTGCTGCGCTTTGCTGTGCAATGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3273322-3274014	Sequence	ECO26_3342 - DNA transfer protein (Protein is coded in complementary strand; from 3274014 to 3273322)