Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 3245632
End position: 3245656
Length: 25

DNA sequence
>NC_013361, from 3245632 to 3245656 (25 bp); Escherichia coli O26:H11 str. 11368 ACGGAACAGATCGGAACGAATCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3245282-3246214	Sequence	ECO26_3318 prmB N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase (Protein is coded in complementary strand; from 3246214 to 3245282)