Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 2158548
End position: 2158583
Length: 36

DNA sequence
>NC_013361, from 2158548 to 2158583 (36 bp); Escherichia coli O26:H11 str. 11368 TATTCTCTGTAGTAATCTCTGTTGTATTCTCTGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2158082-2159047	Sequence	ECO26_2200 - replication protein (Protein is coded in complementary strand; from 2159047 to 2158082)