Sequence retrieval

Genome: Escherichia coli O26:H11 str. 11368
Start position: 1549518
End position: 1549541
Length: 24

DNA sequence
>NC_013361, from 1549518 to 1549541 (24 bp); Escherichia coli O26:H11 str. 11368 ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1549453-1550625	Sequence	ECO26_1551 torC trimethylamine N-oxide reductase I, cytochrome c-type subunit