Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 528689
End position: 528718
Length: 30

DNA sequence
>NC_013222, from 528689 to 528718 (30 bp); Robiginitalea biformata HTCC2501 GCCCATTCCTGCCCATTTCTGCCAATTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF.. 527959-528690	Sequence	RB2501_05665 - hypothetical protein