Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 3362085
End position: 3362147
Length: 63

DNA sequence
>NC_013222, from 3362085 to 3362147 (63 bp); Robiginitalea biformata HTCC2501 TTTATCAGATTCAGGCCATAACGTTTCAGGTTCAGGCCATAACTTTTCAGGTTCGGGCCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 3361557-3362156	Sequence	RB2501_02520 - hypothetical protein (Protein is coded in complementary strand; from 3362156 to 3361557)