Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 3268498
End position: 3268521
Length: 24

DNA sequence
>NC_013222, from 3268498 to 3268521 (24 bp); Robiginitalea biformata HTCC2501 CCGTCCCCGTCATCGTCCACGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 3266698-3270159	Sequence	RB2501_02050 - thrombospondin type 3 repeat family protein/Calx-beta domain-containing protein (Protein is coded in complementary strand; from 3270159 to 3266698)