Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2839749
End position: 2839805
Length: 57

DNA sequence
>NC_013222, from 2839749 to 2839805 (57 bp); Robiginitalea biformata HTCC2501 TGCCGGGCCCTATTCCAGTTGCAGGGCCCTATTCCAGTTGCAGGGACCTAATCCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF... 2839797-2841602	Sequence	RB2501_00206 - TonB-dependent receptor (Protein is coded in complementary strand; from 2841602 to 2839797)