Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2798642
End position: 2798692
Length: 51

DNA sequence
>NC_013222, from 2798642 to 2798692 (51 bp); Robiginitalea biformata HTCC2501 ACCGGCTACGATGCGATTCCGGCCCCGATGCGATTCCGGCTACGAGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF... 2798648-2798797	Sequence	RB2501_16189 - hypothetical protein (Protein is coded in complementary strand; from 2798797 to 2798648)
ORF... 2798670-2799770	Sequence	RB2501_00005 - glycosyl hydrolase