Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2359419
End position: 2359463
Length: 45

DNA sequence
>NC_013222, from 2359419 to 2359463 (45 bp); Robiginitalea biformata HTCC2501 CCCGCTGATCTCCTTCCGGCGGATCTCCTTCCGGCCGATCACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 2358436-2359635	Sequence	RB2501_14124 - hypothetical protein