Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2294359
End position: 2294385
Length: 27

DNA sequence
>NC_013222, from 2294359 to 2294385 (27 bp); Robiginitalea biformata HTCC2501 GAACCCGGAGAACCCGGAGAACCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 2293490-2294683	Sequence	RB2501_13724 - hypothetical protein