Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2278806
End position: 2278856
Length: 51

DNA sequence
>NC_013222, from 2278806 to 2278856 (51 bp); Robiginitalea biformata HTCC2501 CTGCAGTTTAATTCGGGCTGCAGTTTAATTCAGGCTGCAGTTTAATTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF... 2278848-2279408	Sequence	RB2501_13639 - transcriptional regulator (Protein is coded in complementary strand; from 2279408 to 2278848)