Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2224380
End position: 2224424
Length: 45

DNA sequence
>NC_013222, from 2224380 to 2224424 (45 bp); Robiginitalea biformata HTCC2501 TTCCTCCCCTGGGGTTTCCTCCCCGGTAGTTTCCTCCCCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 2221708-2224572	Sequence	RB2501_13424 - hypothetical protein (Protein is coded in complementary strand; from 2224572 to 2221708)