Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2182059
End position: 2182118
Length: 60

DNA sequence
>NC_013222, from 2182059 to 2182118 (60 bp); Robiginitalea biformata HTCC2501 TTACGAGCTTGTCCTGATTTATACGCGCCTGTCCTGATTTATACGCGCCTGTCCGGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF... 2182118-2184784	Sequence	RB2501_13254 - hypothetical protein (Protein is coded in complementary strand; from 2184784 to 2182118)