Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2155780
End position: 2155803
Length: 24

DNA sequence
>NC_013222, from 2155780 to 2155803 (24 bp); Robiginitalea biformata HTCC2501 CGTACTGGTACTCGTACCCGTACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 2153283-2156855	Sequence	RB2501_13144 - hypothetical protein (Protein is coded in complementary strand; from 2156855 to 2153283)