Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 2144476
End position: 2144529
Length: 54

DNA sequence
>NC_013222, from 2144476 to 2144529 (54 bp); Robiginitalea biformata HTCC2501 TTCCCGGGAGATCAATTCTTTCCGGGAGACCAGTTCTTTCCGGGCGATCCATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 2144153-2144605	Sequence	RB2501_13109 - hypothetical protein