Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1949249
End position: 1949272
Length: 24

DNA sequence
>NC_013222, from 1949249 to 1949272 (24 bp); Robiginitalea biformata HTCC2501 TCAAATCTTCAAATCGACAAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1949158-1949520	Sequence	RB2501_12312 - hypothetical protein (Protein is coded in complementary strand; from 1949520 to 1949158)