Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1662761
End position: 1662787
Length: 27

DNA sequence
>NC_013222, from 1662761 to 1662787 (27 bp); Robiginitalea biformata HTCC2501 ATCCTGACCATCCTGGCCATCCTCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1662288-1663541	Sequence	RB2501_10842 - membrane transport protein