Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1570418
End position: 1570462
Length: 45

DNA sequence
>NC_013222, from 1570418 to 1570462 (45 bp); Robiginitalea biformata HTCC2501 TCCCTGCCGGTTCAATCCCTGCCGGTTCAATCCCTGCCGGTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1570332-1572119	Sequence	RB2501_10437 - hypothetical protein