Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1330077
End position: 1330100
Length: 24

DNA sequence
>NC_013222, from 1330077 to 1330100 (24 bp); Robiginitalea biformata HTCC2501 CGTCGTCGTCGTCGTCCTCATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1329065-1333426	Sequence	RB2501_09320 - hypothetical protein (Protein is coded in complementary strand; from 1333426 to 1329065)