Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1316546
End position: 1316572
Length: 27

DNA sequence
>NC_013222, from 1316546 to 1316572 (27 bp); Robiginitalea biformata HTCC2501 TTTGTCCTTTTTGTCCTTTTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1316286-1316642	Sequence	RB2501_09260 - hypothetical protein (Protein is coded in complementary strand; from 1316642 to 1316286)