Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1312108
End position: 1312131
Length: 24

DNA sequence
>NC_013222, from 1312108 to 1312131 (24 bp); Robiginitalea biformata HTCC2501 CCAACCCCAGCCCCAACCCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1311869-1312423	Sequence	RB2501_09230 - lipoprotein (Protein is coded in complementary strand; from 1312423 to 1311869)