Sequence retrieval

Genome: Robiginitalea biformata HTCC2501
Start position: 1133951
End position: 1133975
Length: 25

DNA sequence
>NC_013222, from 1133951 to 1133975 (25 bp); Robiginitalea biformata HTCC2501 ACCGGACCGAAACGGACCCGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1-3530382	Sequence	RB2501_03305 - hypothetical protein
ORF. 1131325-1135053	Sequence	RB2501_08485 - hypothetical protein (Protein is coded in complementary strand; from 1135053 to 1131325)